Topics

<Return to clone list

ID  21-11
Registered  2004.06.01    Last Update  2019.03.14
Gene Name New Gene Symbol New
Chromosome 1 Genomic Location chr1:197,067,290-197,068,504
Synonyms
Links UCSC Browser(chr1:197,067,290-197,068,504)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21 Cell Line KTPU10 Method 5'-RACE
Accession AB187231 GSS Location chr1:197,067,762-197,068,031 Size 284
Sequence ATACTTTCGTTTTTGGGTGCCCGAGTCTAGCCCGCGTTCGCTATGTTCGGGCGGGACGATGGGGA
CCGTTTGTGCCACTCGGGAGAAGTGGTGGGTGGGTACGCTGCTCCGTCGTGCGTGCGTGAGTGTC
GGAACCTGAGCTCGGGAGACCCTCCGGAGAGACAGAATGAGTGAGTGAATGTGGCGGCGCGTGAG
CGATCTGTATTGTTTTGTATGGTTGATCGAGACCATTGTCGGGCGACACCTAGTGGTGACAAGTT
TCGNNTANGCTCCAGGCCTCTCAG
Links UCSC Browser(chr1:197,067,762-197,068,031)
IGTC(Ayu21-11)

Homology Search Results

[X82564] M.musculus 45S pre rRNA gene.

Mouse Information

Card ID 2769 Strain Name B6;CB-Gt(pU-21)11Card
Internal Code Ayu21-11
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for New)

<Return to clone list