Topics

<Return to clone list

ID  21-16
Registered  2004.06.01    Last Update  2018.03.26
Gene Name heat shock protein 8 Gene Symbol Hspa8
Chromosome 9 Genomic Location chr9:40,609,200-40,613,500
Synonyms Hspa10, Hsc73, Hsc70, Hsc71, 70kDa, Hsp73, Hspa10, 2410008N15Rik
Links UCSC Browser(chr9:40,609,200-40,613,500)
NCBI Entrez Gene(15481)
IGTC(Hspa8, 12489)
UniGene(Mm.290774)
MGI(105384)
KEGG GENES(mmu:15481)
EST Profile(Mm.290774)
Other clone trapped this gene
Trap vector pU-21 Cell Line KTPU10 Method 5'-RACE
Accession AB187233 GSS Location chr9:40,609,356-40,609,431 Size 86
Sequence TGGGGAGGCTGGTCTCATTGAACGCGGAGGCAGCTGCCGGGCATTCGTGTGGTCTCGTCGTCAGC
GCAGCTGGGCCTACACACAAG
Links UCSC Browser(chr9:40,609,356-40,609,431)
IGTC(Ayu21-16)

Homology Search Results

[U73744] Mus musculus heat shock 70 protein (Hsc70) gene, complete cds.

Mouse Information

Card ID 687 Strain Name B6;CB-Hspa8Gt(pU-21)16Imeg
Internal Code Ayu21-16
Description This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Hspa8)

<Return to clone list