Topics |
Gene Name | heat shock protein 8 | Gene Symbol | Hspa8 | ||||
---|---|---|---|---|---|---|---|
Chromosome | 9 | Genomic Location | chr9:40,609,200-40,613,500 | ||||
Synonyms | Hspa10, Hsc73, Hsc70, Hsc71, 70kDa, Hsp73, Hspa10, 2410008N15Rik | ||||||
Links | UCSC Browser(chr9:40,609,200-40,613,500) NCBI Entrez Gene(15481) IGTC(Hspa8, 12489) UniGene(Mm.290774) |
MGI(105384) KEGG GENES(mmu:15481) EST Profile(Mm.290774) |
Other clone trapped this gene |
---|
Trap vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
---|---|---|---|---|---|
Accession | AB187233 | GSS Location | chr9:40,609,356-40,609,431 | Size | 86 |
Sequence | TGGGGAGGCTGGTCTCATTGAACGCGGAGGCAGCTGCCGGGCATTCGTGTGGTCTCGTCGTCAGC GCAGCTGGGCCTACACACAAG |
||||
Links | UCSC Browser(chr9:40,609,356-40,609,431) IGTC(Ayu21-16) |
[U73744] Mus musculus heat shock 70 protein (Hsc70) gene, complete cds. |
Card ID | 687 | Strain Name | B6;CB-Hspa8Gt(pU-21)16Imeg |
---|---|---|---|
Internal Code | Ayu21-16 | ||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
Links |
IMSR (for Hspa8) |