Topics

<Return to clone list

ID  21-19
Registered  2005.12.15    Last Update  2020.06.09
Gene Name 18S rRNA gene Gene Symbol 18SrRNA
Chromosome Unlocalized Genomic Location Unlocalized
Synonyms
Links UCSC Browser(Unlocalized)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21 Cell Line KTPU10 Method 5'-RACE
Accession AB187236 GSS Location Size 387
Sequence CGGTAGCTCCCTCCCGGCTCCGGCCGGGGGTCGGGCGCCGGCGGCTTTGGTACTCTAGATAACCT
CGGGCCGATCGCACGCCCCCCGTGGCGGCGACGACCCATTCGAACGTCTTGCCCTATCAACTTTC
GATGGTAGTCGCCGTGCCTACCATGGTGACCACGGGTGACGGGGAATCAGGGTTCGATTCCGGAG
AGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCG
ACCCGGGGAGGTANNNAAGAAAAATAACAATACAGGACTCTTTCGAGGCCCTGTAATTGGAATGA
GTCCACTTTAAATCCTTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGG
Links UCSC Browser
IGTC(Ayu21-19)

Homology Search Results

[X00686] Mouse gene for 18S rRNA.

Mouse Information

Card ID 2823 Strain Name B6;CB-18SrRNAGt(pU-21)19Card
Internal Code Ayu21-19
Description This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for 18SrRNA)

<Return to clone list