| Topics |
ID 21-27
| Gene Name | 45S rRNA gene | Gene Symbol | 45SrRNA | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | Unlocalized | Genomic Location | Unlocalized | ||||
| Synonyms | |||||||
| Links | UCSC Browser(Unlocalized) NCBI Entrez Gene IGTC UniGene |
MGI KEGG GENES EST Profile |
|||||
| Other clone trapped this gene |
|---|
| 21-W237, 21-77, 21-111, 21-40, 21-B105, 21-B197, 21-T25, 21-B170, 21-B150, 21-T22, 21-T42, 21-T90, 21-T110, 21-T1, 21-B203, 21-KBW171, 21-T184, 21-B121, 21-T109, 21-T185, 21-T189, 21-T339, 21-T204, 21-T211, 21-B136, 21-T428, 21-T454, 21-T103, 21-T482, 21-W70, 21-W92, 21-T111, 21-MT90, 21-W100, 21-W130, 21-T284, 21-W137, 21-W212, 21-MT61, 21-KBW217, 21-W332, 21-T302, 21-MT31, 21-MT45, 21-W325, 21-W342, 21-W369, 21-W381, 21-W531, 21-W547, 21-W555, 21-MT38, 21-T205, 21-T267, 21-MT50, 21-MT40, 21-MT53, 21-MT79, 21-MT142, 21-MT110, 21-MT114, 21-B187, 21-B199, 21-W264 |
| Trap vector | pU-21 | Cell Line | KTPU10 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB187239 | GSS Location | Size | 130 | |
| Sequence | CCGGGGGACACACACACACACACACACACACACACACACACACACAGGCGGGCGCGCGCGGCGAT GAGGGGAAGTCGTGCCTAAAATAAATATTTTTCTGGCCAAAGTGAAAGCAAATCACTATGAAGAG |
||||
| Links | UCSC Browser IGTC(Ayu21-27) |
||||
Homology Search Results
| [X82564] M.musculus 45S pre rRNA gene. |
Mouse Information
| Card ID | 348 | Strain Name | B6;CB-Gt(Ayu21)27Imeg |
|---|---|---|---|
| Internal Code | Ayu21-27 | ||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
| Links |
IMSR (for 45SrRNA) |
||