Topics

<Return to clone list

ID  21-4
Registered  2007.07.26    Last Update  2018.04.05
Gene Name crystallin beta-gamma domain containing 2 Gene Symbol Crybg2
Chromosome 4 Genomic Location chr4:133,623,900-133,649,000
Synonyms Aim1l
Links UCSC Browser(chr4:133,623,900-133,649,000)
NCBI Entrez Gene(230806)
IGTC(Crybg2, 36214)
UniGene(Mm.240080)
MGI(1334463)
KEGG GENES(mmu:230806)
EST Profile(Mm.240080)
Other clone trapped this gene
Trap vector pU-21 Cell Line KTPU10 Method 5'-Plasmid Rescue
Accession AB353112 GSS Location chr4:133,643,565-133,643,849 Size 322
Sequence CAGCCCTCTCTAAATGGGCCATCACCTGGCAAAAGCTGGCCTGCCTCTCAGCCAGTCTGCGTGTC
AGTCAGTTGGTCCCATCCCAGTGCGACACACCCCTCTGCACTGTCACCTTTAGGTCTCGCTTATC
TAAGTCTGGTGTCTCCAGGAACTATTTCAGTGAATGTTCAAAAAACACTTGGTCAGTTGAGCTGC
CTCAGGGGCCTCAGAATCAAGGGCACACTGAGAGACTCGGGAAGCCATTGCTCATCCAGGCCACT
AGGTGGCAGGTGAGACAGGACACTTCCGCTGGTGAGTTCCCCATCCAGATGACAGAGGTAGT
Links UCSC Browser(chr4:133,643,565-133,643,849)
IGTC(Ayu21-4)

Homology Search Results

[AK145690] Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0030D16 product:absent in melanoma 1-like, full insert sequence.

Mouse Information

Card ID 524 Strain Name B6;CB-Gt(Ayu21)4Imeg
Internal Code Ayu21-4
Description This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. This sequence-tag is genomic sequence of 5'-flanking region obtained by plasmid rescue.
Links IMSR (for Crybg2)

<Return to clone list