Topics

<Return to clone list

ID  21-55
Registered  2004.06.01    Last Update  2018.04.05
Gene Name RIKEN cDNA 2810004N23 gene Gene Symbol 2810004N23Rik
Chromosome 8 Genomic Location chr8:127,363,000-127,387,800
Synonyms GtAyu21-55, Gt(Ayu21)55Imeg, Ayu21-55, 3110004G14Rik, Gt(pU21)55Imeg
Links UCSC Browser(chr8:127,363,000-127,387,800)
NCBI Entrez Gene(66523)
IGTC(2810004N23Rik, 6377)
UniGene(Mm.436864)
MGI(1913773)
KEGG GENES(mmu:66523)
EST Profile(Mm.436864)
Other clone trapped this gene
Trap vector pU-21 Cell Line KTPU10 Method 5'-RACE
Accession AB187244 GSS Location chr8:127,384,846-127,385,172 Size 392
Sequence TATTCCANGGGGGANAGATTGGATTCGTAGCTCNTGTTGGGGCANTCTTGCGCGTTTGGNCCCTT
NCGACNTGGAGAGACGGAAGGTGAACAGAGCAGAAAGGTCCGAAAGAAGAAGCAAAGAAGAGAGA
CTCAGGGACTATAGAAGATGTGCAGTAGAGCGTTCCCCTGCCTGGATCTCCTGTACGAGGCCAGA
AGAAGAGTGCTTCCAGCTTTTTCCAGAAGCTCAGAGAAGAACTGCAGTCTGCTCCCGCTGCCCCT
TCAGAAGTCCCTGTCACTACTGCAGTCTCCCTCTCTCCCCCAAAGAACGGCAGCAAGCTAGTGGA
AGTGGTAGAGTTTCAAAGCAAAAGTAAAAAGAGAAAACTAAAGTCAGATGAAGATGAGCCGGCAA
AG
Links UCSC Browser(chr8:127,384,846-127,385,172)
IGTC(Ayu21-55)

Homology Search Results

[BC023675] Mus musculus RIKEN cDNA 2810004N23 gene, mRNA (cDNA clone MGC:35729 IMAGE:5354472), complete cds.

Mouse Information

Card ID 393 Strain Name B6;CB-Gt(Ayu21)55Imeg
Internal Code Ayu21-55
Description This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for 2810004N23Rik)

<Return to clone list