Topics

<Return to clone list

ID  21-93
Registered  2004.07.17    Last Update  2018.04.05
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 4 Gene Symbol Abcc4
Chromosome 14 Genomic Location chr14:118,870,000-119,109,000
Synonyms MOAT-B, MRP4, Mrp4, D630049P08Rik, ABCC4-N1
Links UCSC Browser(chr14:118,870,000-119,109,000)
NCBI Entrez Gene(239273)
IGTC(Abcc4, 3512)
UniGene(Mm.40537)
MGI(2443111)
KEGG GENES(mmu:239273)
EST Profile(Mm.40537)
Other clone trapped this gene
21-B6T59, 21-T201, 21-W99, 21-KBW124
Trap vector pU-21 Cell Line KTPU10 Method 5'-RACE
Accession AB187252 GSS Location chr14:119,067,569-119,105,413 Size 386
Sequence AAGCTCCGGCCAAGGCCGGAGTNGAGCATCTTCACCCGCGCTTCCCGGAGCGCCGNCCGGCCGCG
CGCACCGCGGGCGAGATGCTGCCGGTGCACACCGAGGTAAACCCAACCCGCTGCAGGACGCCAAC
CTCTGCTCGCGCGTGTTCTTCTGGGGCTCAACCCGCTTGTTTAAAACTGGTCATAAGCGGAGACT
GGAAGAAGATGACATGTTCTCAGTGCTTCCAGAAGATCGCTCAAAGCACCTCGGAGAGGAGCTTC
AACGGTACTGGGATAAAGAACTTCTGCGAGCCAAGAAGGACTCGAGGAAGCCCTCCTTAACAAAG
GCAATCATAAAGTGTTACTGGAANTCTTACCTGATTTTGGGAATTTTTTACGTTAATTGAG
Links UCSC Browser(chr14:119,067,569-119,105,413)
IGTC(Ayu21-93)

Homology Search Results

[BB643073] RIKEN full-length enriched, 9.5 days embryo parthenogenote Mus musculus cDNA clone B130008G09 5', mRNA sequence.

Mouse Information

Card ID 488 Strain Name B6;CB-Abcc4Gt(Ayu21)93Imeg
Internal Code Ayu21-93
Description This clone was isolated by using the exchangeable gene trap vector;pU-21, and feeder free ES cell line; KTPU10 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Abcc4)

<Return to clone list