Topics

<Return to clone list

ID  21-B114
Registered  2005.06.15    Last Update  2019.10.19
Gene Name NOL1/NOP2/Sun domain family member 2 Gene Symbol Nsun2
Chromosome 13 Genomic Location chr13:69,750,500-69,775,000
Synonyms Misu, D13Wsu123e
Links UCSC Browser(chr13:69,750,500-69,775,000)
NCBI Entrez Gene(28114)
IGTC(Nsun2, 5565)
UniGene(Mm.260009)
MGI(107252)
KEGG GENES(mmu:28114)
EST Profile(Mm.260009)
Other clone trapped this gene
Trap vector pU-21B Cell Line KTPU8 Method 5'-RACE
Accession AB217778 GSS Location chr13:69,751,273-69,751,920 Size 169
Sequence ACCAATTCATGGAGTCACTCCGAGAACCTCTCCCAGCCACACTGAGAATCACTGGGTACAAAAGC
CATGCCAAAGAGATTCTCCATTGCTTGAAGAACAAGTACTTTAAGGAGTTGGAGGACCTGGAAGT
AGATGGACAGAAAGTTGAAGTTCCACAACCACTAAGCTG
Links UCSC Browser(chr13:69,751,273-69,751,920)
IGTC(Ayu21-B114)

Homology Search Results

[AK030124] Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932443I04 product:hypothetical NOL1/NOP2/sun family containing protein, full insert sequence.

Mouse Information

Card ID 636 Strain Name B6;CB-Nsun2Gt(pU-21B)114Imeg
Internal Code Ayu21-B114
Description This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Mammalian NSUN2 introduces 5-methylcytidines into mitochondrial tRNAs." Saori Shinoda, Sho Kitagawa, Shinichi Nakagawa, Fan-Yan Wei, Kazuhito Tomizawa, Kimi Araki, Masatake Araki, Takeo Suzuki and Tsutomu Suzuki, Nuc. Acids Res., 47, 8734-8745(2019). pii: gkz575. doi: 10.1093/nar/gkz575. [Epub ahead of print] PubMed ID:31287866.
Links IMSR (for Nsun2)

<Return to clone list