Topics |
Gene Name | retinoic acid receptor, alpha | Gene Symbol | Rara | ||||
---|---|---|---|---|---|---|---|
Chromosome | 11 | Genomic Location | chr11:98,786,000-98,840,000 | ||||
Synonyms | RAR alpha 1, RARalpha1 | ||||||
Links | UCSC Browser(chr11:98,786,000-98,840,000) NCBI Entrez Gene(19401) IGTC(Rara, 14073) UniGene(Mm.439744) |
MGI(97856) KEGG GENES(mmu:19401) EST Profile(Mm.439744) |
Other clone trapped this gene |
---|
Trap vector | pU-21B | Cell Line | KTPU8 | Method | 5'-RACE |
---|---|---|---|---|---|
Accession | AB217779 | GSS Location | chr11:98,789,146-98,789,224 | Size | 80 |
Sequence | AATCCTGAATCGAGCTGAGAGGGCTTCCCCGGTTCTTCCTGGGAACCCCATCGCCCCCCTGCCGG CACACACCTGAGCAG |
||||
Links | UCSC Browser(chr11:98,789,146-98,789,224) IGTC(Ayu21-B115) |
[BC008727] Homo sapiens retinoic acid receptor, alpha, mRNA (cDNA clone MGC:1651 IMAGE:3163891), complete cds. |
Card ID | 643 | Strain Name | |
---|---|---|---|
Internal Code | |||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||
Links |
IMSR (for Rara) |