Topics

<Return to clone list

ID  21-B196
Registered  2007.03.29    Last Update  2018.04.05
Gene Name adiponectin receptor 2 Gene Symbol Adipor2
Chromosome 6 Genomic Location chr6:119,302,000-119,370,000
Synonyms D6Ucla1e, 1110001I14Rik, ADCR2, Paqr2, AI115388, AW554121
Links UCSC Browser(chr6:119,302,000-119,370,000)
NCBI Entrez Gene(68465)
IGTC(Adipor2, 287)
UniGene(Mm.291826)
MGI(93830)
KEGG GENES(mmu:68465)
EST Profile(Mm.291826)
Other clone trapped this gene
Trap vector pU-21B Cell Line KTPU8 Method 5'-RACE
Accession AB299416 GSS Location chr6:119,367,438-119,367,543 Size 106
Sequence ATTACTTTCCCACATGTGCCTGGTGCAAGTCTTTCCACACAACACAAGAATCCGTGGAGCTCAGC
AGTACCCTCAGACTCTGGTCTACAACTCTGACAGGATTTGG
Links UCSC Browser(chr6:119,367,438-119,367,543)
IGTC(Ayu21-B196)

Homology Search Results

[AK039667] Mus musculus adult male spinal cord cDNA, RIKEN full-length enriched library, clone:A330081F11 product:hypothetical Uncharacterised protein family Hly-III/UPF0073 containing protein, full insert sequence.

Mouse Information

Card ID 1437 Strain Name B6;CB-Adipor2Gt(pU-21B)196Card
Internal Code Ayu21-B196
Description This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Adipor2)

<Return to clone list