Topics

<Return to clone list

ID  21-B199
Registered  2015.05.13    Last Update  2015.06.04
Gene Name 45S rRNA gene Gene Symbol 45SrRNA
Chromosome Unlocalized Genomic Location Unlocalized
Synonyms
Links UCSC Browser(Unlocalized)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone trapped this gene
21-W237, 21-27, 21-77, 21-111, 21-40, 21-B105, 21-B197, 21-T25, 21-B170, 21-B150, 21-T22, 21-T42, 21-T90, 21-T110, 21-T1, 21-B203, 21-KBW171, 21-T184, 21-B121, 21-T109, 21-T185, 21-T189, 21-T339, 21-T204, 21-T211, 21-B136, 21-T428, 21-T454, 21-T103, 21-T482, 21-W70, 21-W92, 21-T111, 21-MT90, 21-W100, 21-W130, 21-T284, 21-W137, 21-W212, 21-MT61, 21-KBW217, 21-W332, 21-T302, 21-MT31, 21-MT45, 21-W325, 21-W342, 21-W369, 21-W381, 21-W531, 21-W547, 21-W555, 21-MT38, 21-T205, 21-T267, 21-MT50, 21-MT40, 21-MT53, 21-MT79, 21-MT142, 21-MT110, 21-MT114, 21-B187, 21-W264
Trap vector pU-21B Cell Line KTPU8 Method 5'-Inverse PCR
Accession DE999380 GSS Location Unlocalized Size 301
Sequence AACTGCAATCATAGCAGACATATTATACACACACACACAAANTCTGTCATAAAATCCAATGTGCC
TTCATGATCAAAGTTCAATAGTCAGTAATACTAGAAGAATCATATGTCTGAAAATAAAAGCCAGA
ACCTTTTCTGCTTTTGTTTTCTTTTGCCCCAAGATAGGGTTTCTCTCAGTGTATCCCTGGCATCC
CTGCCTGGAACTTGCTTTGTAGGCTTTGGTAGCCTCAAACTCAGAGAGGTCCTCTCTGCCTGCCT
GCCTGCCTGCCTGCCTGCCTCACTTATTCTGCCACCCACAC
Links UCSC Browser(Unlocalized)
IGTC

Homology Search Results

Mouse Information

Card ID 657 Strain Name B6;CB-45SrRNAGt(pU-21B)199Imeg
Internal Code Ayu21-B199
Description This clone was isolated by using the exchangeable gene trap vector;pU-21B, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. This sequence-tag is genomic sequence of 5'-flanking region obtained by inverse PCR.
Links IMSR (for 45SrRNA)

<Return to clone list