Topics

<Return to clone list

ID  21-B6T16
Registered  2006.04.13    Last Update  2015.05.16
Gene Name MOK protein kinase Gene Symbol Mok
Chromosome 12 Genomic Location chr12:112,046,000-112,080,000
Synonyms MAPK/MAK/MRK/ overlapping kinase, MOK, Rage, Stk30
Links UCSC Browser(chr12:112,046,000-112,080,000)
NCBI Entrez Gene(26448)
IGTC(Mok, 6360)
UniGene(Mm.140948)
MGI(1336881)
KEGG GENES(mmu:26448)
EST Profile(Mm.140948)
Other clone trapped this gene
Trap vector pU-21T Cell Line KMB6-6 Method 5'-RACE
Accession AB257130 GSS Location chr12:112,072,336-112,079,132 Size 294
Sequence TGGACAGGAATACAATATGGCGGCCAGATCCTAACGCTCCCCAGCCAGGGACCACCGCGAAGGTC
CTCGAGCCGGAAGCCACCTCTGGAAGGGAGAAGGCCGGTACCACAGTCTCCTCTTTTCTTTTCGG
TCCGGGGCCGTCCAGGGGCTGACGGCGTCATCCGCGTTCAGGATGAAGAACTACAAAGCAATTGG
CAAGATAGGAGAGGGGACGTTTTCTGAAGTTATGAAGATGCAGAGTCTGAGAGATGGGAATTACT
ATGCGTGCAAACAAATGAAGCAGCACTTTGAAAG
Links UCSC Browser(chr12:112,072,336-112,079,132)
IGTC(Ayu21-B6T16)

Homology Search Results

[AB022695] Mus musculus mRNA for MOK protein kinase, complete cds.

Mouse Information

Card ID 654 Strain Name B6-MokGt(pU-21B6T)16Imeg
Internal Code Ayu21-B6T16
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KMB6-6 (C57BL/6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Mok)

<Return to clone list