Topics

<Return to clone list

ID  21-B6T19
Registered  2015.06.03    Last Update  2018.04.06
Gene Name filamin binding LIM protein 1 Gene Symbol Fblim1
Chromosome 4 Genomic Location chr4:141,131,000-141,163,000
Synonyms Cal, Gt10, 2410043F08Rik, Fblp1, migfilin, migfilin(s)
Links UCSC Browser( chr4:141,131,000-141,163,000)
NCBI Entrez Gene(74202)
IGTC(Fblim1, 1577)
UniGene(Mm.490327)
MGI(1921452)
KEGG GENES(mmu:74202)
EST Profile(Mm.490327)
Other clone trapped this gene
21-T327, 21-KBW66
Trap vector pU-21T Cell Line KMB6-6 Method 5'-Inverse PCR
Accession DE999382 GSS Location chr4:141,156,523-141,156,739 Size 217
Sequence GGGGGGGGGGGCGAGGAGGGCTGCAGAAGGGGACCTAATCCTTCCTAGTTACCCCCCCCCCATGA
CTCTGGGTCCAGCTCTCCCCTGCCCAGTCCCCCATTGTGCCTCTAATCGAAAGAACAATCGGCTT
GCCTGGGAATCAGACCTAGATTCCTTTCCCCTGCAATGTCTTCAGGTCTCTAGGGACCTGAGCTG
TCCAGAGCAGCCCCAACCCAGG
Links UCSC Browser(chr4:141,156,523-141,156,739)
IGTC

Homology Search Results

Mouse Information

Card ID 793 Strain Name B6-Fblim1Gt(pU-21B6T)19Imeg
Internal Code Ayu21-B6T19
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KMB6-6 (C57BL/6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. This sequence-tag is genomic sequence of 5'-flanking region obtained by inverse PCR.
Links IMSR (for Fblim1)

<Return to clone list