| Topics |
ID 21-B6T19
| Gene Name | filamin binding LIM protein 1 | Gene Symbol | Fblim1 | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 4 | Genomic Location | chr4:141,131,000-141,163,000 | ||||
| Synonyms | Cal, Gt10, 2410043F08Rik, Fblp1, migfilin, migfilin(s) | ||||||
| Links | UCSC Browser( chr4:141,131,000-141,163,000) NCBI Entrez Gene(74202) IGTC(Fblim1, 1577) UniGene(Mm.490327) |
MGI(1921452) KEGG GENES(mmu:74202) EST Profile(Mm.490327) |
|||||
| Other clone trapped this gene |
|---|
| 21-T327, 21-KBW66 |
| Trap vector | pU-21T | Cell Line | KMB6-6 | Method | 5'-Inverse PCR |
|---|---|---|---|---|---|
| Accession | DE999382 | GSS Location | chr4:141,156,523-141,156,739 | Size | 217 |
| Sequence | GGGGGGGGGGGCGAGGAGGGCTGCAGAAGGGGACCTAATCCTTCCTAGTTACCCCCCCCCCATGA CTCTGGGTCCAGCTCTCCCCTGCCCAGTCCCCCATTGTGCCTCTAATCGAAAGAACAATCGGCTT GCCTGGGAATCAGACCTAGATTCCTTTCCCCTGCAATGTCTTCAGGTCTCTAGGGACCTGAGCTG TCCAGAGCAGCCCCAACCCAGG |
||||
| Links | UCSC Browser(chr4:141,156,523-141,156,739) IGTC |
||||
Homology Search Results
Mouse Information
| Card ID | 793 | Strain Name | B6-Fblim1Gt(pU-21B6T)19Imeg |
|---|---|---|---|
| Internal Code | Ayu21-B6T19 | ||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KMB6-6 (C57BL/6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. This sequence-tag is genomic sequence of 5'-flanking region obtained by inverse PCR. | ||
| Links |
IMSR (for Fblim1) |
||