Topics

<Return to clone list

ID  21-B6T44
Registered  2006.09.05    Last Update  2017.04.01
Gene Name CD99 antigen Gene Symbol Cd99
Chromosome 4 Genomic Location Unlocalized
Synonyms D4, Pilr-l, pilr-1, 1110061M03Rik, 2410026K10Rik
Links UCSC Browser(Unlocalized)
NCBI Entrez Gene(673094)
IGTC
UniGene(Mm.423040)
MGI(1913728)
KEGG GENES(mmu:673094)
EST Profile(Mm.423040)
Other clone trapped this gene
Trap vector pU-21T Cell Line KMB6-6 Method 5'-RACE
Accession AB272093 GSS Location Unlocalized Size 41
Sequence CGCGGCGAGTGACGACTTCAACCTGGGCGACGCCCTGGAGG
Links UCSC Browser(Unlocalized)
IGTC(Ayu21-B6T44)

Homology Search Results

[AB122023] Mus musculus pilr-l mRNA for paired immunoglobin-like type 2 receptor-ligand, complete cds.
[BC019482] Mus musculus CD99 antigen, mRNA (cDNA clone MGC:28610 IMAGE:4218841), complete cds.

Mouse Information

Card ID 718 Strain Name B6-Cd99Gt(pU-21T)44Imeg
Internal Code Ayu21-B6T44
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KMB6-6 (C57BL/6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "CD99-Dependent Expansion of Myeloid-Derived Suppressor Cells and Attenuation of Graft-Versus-Host Disease." Hyo Jin Park, Dahye Byun, An Hi Lee, Ju Hyun Kim, Young Larn Ban, Masatake Araki, Kimi Araki, Ken-ichi Yamamura, Inho Kim, Seong Hoe Park, and Kyeong Cheon Jung., Molecules and Cells,33, 259-267 (2012). PubMed ID:22350746.
[Paper] "Interaction of CD99 with its paralog CD99L2 positively regulates CD99L2 trafficking to cell surfaces." Girl Nam, Young-Kwan Lee, Hye Yeong Lee, Min Jung Ma, Masatake Araki, Kimi Araki, Seungbox Lee, Im-Soon Lee and Eun Young Choi, J. Immunology, 191 (11), 5730-5742 (2013). PubMed ID:24133166.
[Paper] "Endothelial CD99 supports arrest of mouse neutrophils in venules and binds to neutrophil PILRs." Goswami, D., Marz, S., Li, Y. T., Artz, A., Schafer, K., Seelige, R., Pacheco-Blanco, M., Jing, D., Bixel, M. G., Araki, M., Araki, K., Yamamura, K., Vestweber, D., Blood, 129(13),1811-1822 (2017). doi: 10.1182/blood-2016-08-733394. PubMed ID:28223280.
Links IMSR (for Cd99)

<Return to clone list