Topics |
Gene Name | CD99 antigen | Gene Symbol | Cd99 | ||||
---|---|---|---|---|---|---|---|
Chromosome | 4 | Genomic Location | Unlocalized | ||||
Synonyms | D4, Pilr-l, pilr-1, 1110061M03Rik, 2410026K10Rik | ||||||
Links | UCSC Browser(Unlocalized) NCBI Entrez Gene(673094) IGTC UniGene(Mm.423040) |
MGI(1913728) KEGG GENES(mmu:673094) EST Profile(Mm.423040) |
Other clone trapped this gene |
---|
Trap vector | pU-21T | Cell Line | KMB6-6 | Method | 5'-RACE |
---|---|---|---|---|---|
Accession | AB272093 | GSS Location | Unlocalized | Size | 41 |
Sequence | CGCGGCGAGTGACGACTTCAACCTGGGCGACGCCCTGGAGG | ||||
Links | UCSC Browser(Unlocalized) IGTC(Ayu21-B6T44) |
[AB122023] Mus musculus pilr-l mRNA for paired immunoglobin-like type 2 receptor-ligand, complete cds. |
[BC019482] Mus musculus CD99 antigen, mRNA (cDNA clone MGC:28610 IMAGE:4218841), complete cds. |
Card ID | 718 | Strain Name | B6-Cd99Gt(pU-21T)44Imeg |
---|---|---|---|
Internal Code | Ayu21-B6T44 | ||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KMB6-6 (C57BL/6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "CD99-Dependent Expansion of Myeloid-Derived Suppressor Cells and Attenuation of Graft-Versus-Host Disease." Hyo Jin Park, Dahye Byun, An Hi Lee, Ju Hyun Kim, Young Larn Ban, Masatake Araki, Kimi Araki, Ken-ichi Yamamura, Inho Kim, Seong Hoe Park, and Kyeong Cheon Jung., Molecules and Cells,33, 259-267 (2012). PubMed ID:22350746. [Paper] "Interaction of CD99 with its paralog CD99L2 positively regulates CD99L2 trafficking to cell surfaces." Girl Nam, Young-Kwan Lee, Hye Yeong Lee, Min Jung Ma, Masatake Araki, Kimi Araki, Seungbox Lee, Im-Soon Lee and Eun Young Choi, J. Immunology, 191 (11), 5730-5742 (2013). PubMed ID:24133166. [Paper] "Endothelial CD99 supports arrest of mouse neutrophils in venules and binds to neutrophil PILRs." Goswami, D., Marz, S., Li, Y. T., Artz, A., Schafer, K., Seelige, R., Pacheco-Blanco, M., Jing, D., Bixel, M. G., Araki, M., Araki, K., Yamamura, K., Vestweber, D., Blood, 129(13),1811-1822 (2017). doi: 10.1182/blood-2016-08-733394. PubMed ID:28223280. |
||
Links |
IMSR (for Cd99) |