Topics

<Return to clone list

ID  21-B6T59
Registered  2006.09.20    Last Update  2018.04.06
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 4 Gene Symbol Abcc4
Chromosome 14 Genomic Location chr14:118,880,000-119,110,000
Synonyms MRP4, MOATB, D630049P08Rik, Abcc4, ABCC4-N1
Links UCSC Browser(chr14:118,880,000-119,110,000)
NCBI Entrez Gene(239273)
IGTC(Abcc4, 3512)
UniGene(Mm.40537)
MGI(2443111)
KEGG GENES(mmu:239273)
EST Profile(Mm.40537)
Other clone trapped this gene
21-93, 21-T201, 21-W99, 21-KBW124
Trap vector pU-21T Cell Line KMB6-6 Method 5'-RACE
Accession AB274986 GSS Location chr14:119,105,258-119,105,417 Size 160
Sequence TGCGAGGCTCCGGCCGAGGCCGGAGCTCGAGCATCCTCACCCGCGCTTCCCGGAGCCGCCGCCCG
GCCGCGCGCACCGCGGGCGAGATGCTGCCGGTGCACACCGAGGTGAAACCCAACCCGCTGCAGGA
CGCCAACCTCTGCTCGCGCGTGTTCTTNTG
Links UCSC Browser(chr14:119,105,258-119,105,417)
IGTC(Ayu21-B6T59)

Homology Search Results

[AK043702] Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830021K08 product:hypothetical protein, full insert sequence.
[NM_001033336] Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 4 (Abcc4), mRNA.

Mouse Information

Card ID 725 Strain Name B6-Abcc4Gt(pU-21T)59Imeg
Internal Code Ayu21-B6T59
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KMB6-6 (C57BL/6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Abcc4)

<Return to clone list