Topics

<Return to clone list

ID  21-KBT38
Registered  2009.03.26    Last Update  2018.04.06
Gene Name ankyrin repeat domain 11 Gene Symbol Ankrd11
Chromosome 8 Genomic Location chr8:125,400,000-125,570,000
Synonyms Yod, 2410104C19Rik, 3010027A04Rik, 9530048I21Rik, Gm176; AA930108; 6330578C09Rik
Links UCSC Browser(chr8:125,400,000-125,570,000)
NCBI Entrez Gene(77087)
IGTC(Ankrd11, 819)
UniGene(Mm.31567)
MGI(1924337)
KEGG GENES(mmu:77087)
EST Profile(Mm.31567)
Other clone trapped this gene
21-T183, 21-W277
Trap vector pU-21T Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB491281 GSS Location chr8:125,498,629-125,566,083 Size 299
Sequence CCAGACGCCCCCGCAGTAGCGTCCGCGCGAGCGCCGCGGCCCCGCGTGAGCTCCTGCACGCCGAG
GGCGGGCTTGCATCCCGCCGGCCCCGCACTCGCCGCAGCCTCCAGCCCGCGCGCCGACGCCGCCT
TCCCGCCCGGGCCGCGCGGCCCGGGAAACGCGGCCGCGGGCTGCATGGGCAGCGCCCGCGCCCCG
CCGCCGTTCCGCCGCGGAGCCGCGTCGCCCTCGGAGCCGGAGCATACTGCCCTGCTGGAGTTCAT
ACCCATTCCTGAGCAACACTGGTTTTTGCCATGGAATCC
Links UCSC Browser(chr8:125,498,629-125,566,083)
IGTC(Ayu21-KBT38)

Homology Search Results

[AK138711] Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430020J22 product:hypothetical protein, full insert sequence.

Mouse Information

Card ID 1212 Strain Name B6-Ankrd11Gt(pU-21KBT)38Card
Internal Code Ayu21-KBT38
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
Links IMSR (for Ankrd11)

<Return to clone list