Topics

<Return to clone list

ID  21-KBT47
Registered  2015.06.03    Last Update  2015.06.04
Gene Name erythroid differentiation regulator 1 Gene Symbol Erdr1
Chromosome Y Genomic Location Unlocalized
Synonyms
Links UCSC Browser(Unlocalized)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
21-T47, 21-KBW221, 21-KBW177, 21-W14, 21-KBW106, 21-KBW112, 21-KBW113, 21-KBW116, 21-KBW178, 21-KBW183, 21-W347, 21-KBW154, 21-W442, 21-KBW209, 21-W521, 21-KBW241, 21-KBW252, 21-B173, 21-7, 21-62
Trap vector pU-21T Cell Line KAB6 (Albino B6) Method 5'-Inverse PCR
Accession DE999383 GSS Location Unlocalized Size 218
Sequence GCCGCCTTCCCGCCACTCACTCTGAAAGCCCATAGAGAACCATTGACTACGGCAGGACTACAACT
CCCAGCATGCCTCGGGGCCGCCTTCCCGCCACTCACTCTGAAAGCCCATAGAGAACCATTGACGA
CGGCAGGACTACAACTCCCAGCATGCCTCGGGGCCGCCTTCCCGCCACTCACTCTGAAAGCCCAT
AGAGAACCATTGACTACAATGTT
Links UCSC Browser(Unlocalized)
IGTC(Ayu21-KBT47)

Homology Search Results

[AJ539223] Mus musculus mRNA for erythroid differentiation regulator (edr gene).

Mouse Information

Card ID 1237 Strain Name B6-Erdr1Gt(pU-21KBT)47Card
Internal Code Ayu21-KBT47
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE. This sequence-tag is genomic sequence of 5'-flanking region obtained by inverse PCR.
Links IMSR (for Erdr1)

<Return to clone list