Topics

<Return to clone list

ID  21-KBW110
Registered  2008.10.03    Last Update  2018.04.06
Gene Name Traf3 interacting protein 2 Gene Symbol Traf3ip2
Chromosome 10 Genomic Location chr10:39,332,000-39,376,000
Synonyms Act1, TRAF3 interacting protein 2, Act1, CIKS, AI429613
Links UCSC Browser(chr10:39,332,000-39,376,000)
NCBI Entrez Gene(103213)
IGTC(Traf3ip2, 20434)
UniGene(Mm.436686)
MGI(2143599)
KEGG GENES(mmu:103213)
EST Profile(Mm.436686)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB462424 GSS Location chr10:39,333,049-39,333,152 Size 104
Sequence ACCTGGGACTGGAGAGGGCGAGGGAGGTCTGAGCGGCCCAAGGTGGATCCCCGTGAGCAGAGCCA
GCGACCACCCCCTGGGCCGTCTGTCGGTGGCGATCTTAG
Links UCSC Browser(chr10:39,333,049-39,333,152)
IGTC(Ayu21-KBW110)

Homology Search Results

[BC138234] Mus musculus Traf3 interacting protein 2, mRNA (cDNA clone MGC:169858 IMAGE:8861253), complete cds.

Mouse Information

Card ID 1257 Strain Name B6-Traf3ip2Gt(pU-21KBW)110Card
Internal Code Ayu21-KBW110
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Traf3ip2)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list