Topics

<Return to clone list

ID  21-KBW111
Registered  2008.10.06    Last Update  2019.02.22
Gene Name Mir142 host gene (non-protein coding) Gene Symbol Mir142hg
Chromosome 11 Genomic Location chr11:87,569,000-87,570,900
Synonyms A430104N18Rik, AW909330
Links UCSC Browser(chr11:87,569,000-87,570,900)
NCBI Entrez Gene(78591)
IGTC
UniGene
MGI(1925841)
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB462904 GSS Location chr11:87,569,078-87,569,115 Size 39
Sequence GCACTTTGGATCCAGCTCTTCTCAGCTCTGCAGCATCAG
Links UCSC Browser(chr11:87,569,078-87,569,115)
IGTC(Ayu21-KBW111)

Homology Search Results

[AK020764] Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430104N18 product:unclassifiable, full insert sequence.

Mouse Information

Card ID 1271 Strain Name B6-A430104N18RikGt(pU-21KBW)111Card
Internal Code Ayu21-KBW111
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "MiR-142 is required for Staphylococcus aureus clearance at skin wound sites via small GTPase-mediated regulation of the neutrophil actin cytoskeleton." Tanaka, K., Kim, S. E., Yano, H., Matsumoto, G., Ohuchida, R., Ishikura, Y., Araki, M., Araki, K., Park, S., Komatsu, T., Hayashi, H., Ikematsu, K., Tanaka, K., Hirano, A., Martin, P., Shimokawa, I., Mori, R., J. Invest, Dermatol., 137(4), 931-940 (2017). pii: S0022-202X(16)32664-1. doi: 10.1016/j.jid.2016.11.018. Epub 2016 Nov 25. PubMed ID:27894934.
[Paper] "Identification and functional analysis of inflammation-related miRNAs in skin wound repair." Mori, R., Tanaka, K., Shimokawa, I., Dev. Growth Differ., 60, 306 (2018). doi: 10.1111/dgd.12542. Epub 2018 Jun 5. PubMed ID:29873073.
Links IMSR (for Mir142hg)

<Return to clone list