Topics

<Return to clone list

ID  21-KBW131
Registered  2008.11.11    Last Update  2019.07.29
Gene Name succinate-Coenzyme A ligase, GDP-forming, beta subunit Gene Symbol Suclg2
Chromosome 6 Genomic Location chr6:95,420,000-95,675,000
Synonyms G-SCS; GTPSCS; AF171077; AW556404; D6Wsu120e; SCS-betaG
Links UCSC Browser(chr6:95,420,000-95,675,000)
NCBI Entrez Gene(20917)
IGTC(Suclg2, 4273)
UniGene(Mm.371585)
MGI(1306824)
KEGG GENES(mmu:20917)
EST Profile(Mm.371585)
Other clone traped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB469856 GSS Location chr6:95,668,690-95,668,794 Size 106
Sequence GGCCTCTCTTCAGGTTCCTGGTTAAGATGGCGTCCCCGGTGGCCATCGCGGCGCAGGCTGGGAAG
CTTCTGCGAGAGCGAGCGCTGCGGCCGCTCCTGGCGGTCAG
Links UCSC Browser(chr6:95,668,690-95,668,794)
IGTC(Ayu21-KBW131)

Homology Search Results

[AK172633] Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830222A07 product:succinate-Coenzyme A ligase, GDP-forming, beta subunit, full insert sequence.

Mouse Information

Card ID 1750 Strain Name B6-Suclg2Gt(pU-21KBW)131Card
Internal Code Ayu21-KBW131
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Two transgenic mouse models for beta subunit components of succinate-CoA ligase yielding pleiotropic metabolic alterations." Kacso, G., Ravasz, D., Doczi, J., Nemeth, B., Madgar, O., Saada, A., Ilin, P., Miller, C., Ostergaard, E., Iordanov, I., Adams, D., Vargedo, Z., Araki, M., Araki, K., Nakahara, M., Ito, H., Gal, A., Molnar, M., Nagy, Z., Patocs, A., Adam-Vizi, V. and Chinopoulos, C., Biochemical Journal, 473(20), 3463-3485 (2016). Epub 2016 Aug 5. pii: BCJ20160594. doi: 10.1042/BCJ20160594. PubMed ID:27496549.
Links IMSR (for Suclg2)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list