Topics

<Return to clone list

ID  21-KBW134
Registered  2008.11.11    Last Update  2018.05.26
Gene Name RE1-silencing transcription factor Gene Symbol Rest
Chromosome 5 Genomic Location chr5:77,694,228-77,713,061
Synonyms 2610008J04Rik, NRSF, REST4; AA407358
Links UCSC Browser(chr5:77,694,228-77,713,061)
NCBI Entrez Gene(19712)
IGTC(Rest, 9525)
UniGene(Mm.28840)
MGI(104897)
KEGG GENES(mmu:17912)
EST Profile(Mm.28840)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB469859 GSS Location chr5:77,697,407-77,704,342 Size 517
Sequence AGTTTAAGGCAAGCCTTCCGGTGTAACCTTGCCAGTCGAACCGAATCTGAAGANCAGTTTGTGCA
TCACATCCGGATTCANGAGCGCTAAGAAGTTCTTTGTGGAGGAAAGTGCAGAGAACAGGCCAAAG
CTTGGAGTCGGGGTGTCTCCGGCCGAAGAGGGCGAGTTCTCCAAAGGCCCCATCCGCTGTGACCG
CTGGGCTACAATACCAACCGGTATGACCACTACATGGCACACCTGAAGCACCACCTGCGAGCTGG
CGAGAACGAGCGCATCTACAAGTGCATCATCTGCACGTACACGACGGTCAGCGAGTACCACTGGA
GGAAACACCTGAGAAACCATTTCCCCAGGAAAGTCTACACCTGCAGCAAGTGCAACTACTTCTCA
GACAGAAAAAATAACTACGTTCAGCACGTGCGAACTCACACAGGAGAACGCCCGTATAAATGTGA
ACTTTGTCCTTACTCAAGCTCTCAGAAGACTCATCTAACGCGACACATGCGGACTCATTCAG
Links UCSC Browser(chr5:77,697,407-77,704,342)
IGTC(Ayu21-KBW134)

Homology Search Results

[AK004945] Mus musculus adult male liver cDNA, RIKEN full-length enriched library, clone:1300008L09 product:RE1-silencing transcription factor, full insert sequence.

Mouse Information

Card ID 1811 Strain Name B6-RestGt(pU-21KBW)134Card
Internal Code Ayu21-KBW134
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Rest)

<Return to clone list