Topics

<Return to clone list

ID  21-KBW137
Registered  2008.11.11    Last Update  2018.05.26
Gene Name 1-aminocyclopropane-1-carboxylate synthase (non-functional)-like Gene Symbol Accsl
Chromosome 2 Genomic Location chr2:93,695,000-93,710,000
Synonyms Gm1967
Links UCSC Browser(chr2:93,695,000-93,710,000)
NCBI Entrez Gene(381411)
IGTC(Accsl, 29731)
UniGene(Mm.9889)
MGI(3584519)
KEGG GENES(mmu:381411)
EST Profile(Mm.9889)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB469860 GSS Location chr2:93,709,179-93,709,536 Size 358
Sequence ACCCGATTCATCCCGTGTCTTGCCTGTACACACAGGCCCTGGCTCTAGCCTCCTTCGAAGAGCAG
GGGCCCTCCCAGCCTGTGAACACTTCAGCTGAAGCCAATACTCTTCAGATTTGCTCCAACCGGAT
ACTCCGAGCCAGTTCTCTGTAATTATGCCAAGGCCATCTAGATAATGGGGAGCTGCTGGGTAGTT
GGCTCCAGGAGGGGAAAAGATGGGTCTCATTACCCTGCAAGCCACCTTGTGCTTAAAAGAGAGGG
GAGGGGGCGGAGGAGCAAGCTTCTGCTCCCTGAATGACAAAGACACTCCTGGATTTAGACTTCGG
ACTGCACAGAGATGAGTGAGAACAGAAATGAAG
Links UCSC Browser(chr2:93,709,179-93,709,536)
IGTC(Ayu21-KBW137)

Homology Search Results

[CD547984] B0286D09-5 NIA Mouse Embryonic Germ Cell cDNA Library (Long) Mus musculus cDNA clone NIA:B0286D09 IMAGE:30111692 5', mRNA sequence.

Mouse Information

Card ID 1812 Strain Name B6-AccslGt(pU-21KBW)137Card
Internal Code Ayu21-KBW137
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Accsl)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list