Topics

<Return to clone list

ID  21-KBW143
Registered  2010.12.15    Last Update  2018.05.26
Gene Name polyadenylate binding protein-interacting protein 1 Gene Symbol Paip1
Chromosome 13 Genomic Location chr13:120,217,000-120,250,000
Synonyms PAIP-1
Links UCSC Browser(chr13:120,217,000-120,250,000)
NCBI Entrez Gene(218693)
IGTC(Paip1, 4713)
UniGene(Mm.132584)
MGI(2384993)
KEGG GENES(mmu:218693)
EST Profile(Mm.132584)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB604606 GSS Location chr13:120,219,045-120,229,678 Size 391
Sequence AGCCCCAGGTGGTTGTGGCTCCTGTGTTAATGTCTAAGCTGTCTGCGAACGCCCCCGAATTTTAC
CCATCAGGTTATTCTTCTAATTATACAGAATCCTATGAGGATGGTTGTGAGGATTACCCGACTCT
CTCAGAATACGTTCAGGATTTTCTGAATCATCTGACAGAACAGCCTGGTAGTTTTGAAACAGAAA
TTGAACAGTTTGCAGAAACCCTGAATGGATGGGTCACAACAGATGATGCTTTGCAAGAACTTGTG
GAACTTATCTACCAACAGGCCACGTCTATCCCAAATTTCTCTTACATGGGAGCTCGCCTGTGTAA
TTACCTGTCCCATCATCTGACAATTAGTCCACAGAGTGGCAACTTCCGCCAATTGCTACTTCAAA
G
Links UCSC Browser(chr13:120,219,045-120,229,678)
IGTC(Ayu21-KBW143)

Homology Search Results

[NM_145457] Mus musculus polyadenylate binding protein-interacting protein 1 (Paip1), transcript variant 1, mRNA.

Mouse Information

Card ID 1855 Strain Name B6-Paip1Gt(pU-21KBW)143Card
Internal Code Ayu21-KBW143
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Paip1)

<Return to clone list