Topics

<Return to clone list

ID  21-KBW165
Registered  2011.02.06    Last Update  2018.05.27
Gene Name Riken cDNA E330020D12 gene Gene Symbol E330020D12Rik
Chromosome 1 Genomic Location chr1:155,251,000-155,262,000
Synonyms Gm6648
Links UCSC Browser(chr1:155,251,000-155,262,000)
NCBI Entrez Gene(626058)
IGTC(E330020D12Rik, 24831)
UniGene(Mm.31556)
MGI(3761270)
KEGG GENES(mmu:626058)
EST Profile(Mm.31556)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB609133 GSS Location chr1:155,261,275-155,261,361 Size 87
Sequence GTTCCCGTAGCAGCATCGAGGTGTTCCTGAGATAAAGAAGGCTGTTGAGAAGAATCGGACCGTGT
TGCGTTTTTCTTGCTGGACGAG
Links UCSC Browser(chr1:155,261,275-155,261,361)
IGTC

Homology Search Results

[NR_033736] Mus musculus Riken cDNA E330020D12 gene (E330020D12Rik), non-coding RNA.

Mouse Information

Card ID 1898 Strain Name B6-GE330020D12RikGt(pU-21KBW)165Card
Internal Code Ayu21-KBW165
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for E330020D12Rik)

<Return to clone list