Topics

<Return to clone list

ID  21-KBW169
Registered  2011.02.06    Last Update  2018.05.27
Gene Name transcription factor Dp 2 Gene Symbol Tfdp2
Chromosome 9 Genomic Location chr9:96,093,637-96,225,351
Synonyms DP3, DP-3, 1110029I05Rik, A330080J22Rik
Links UCSC Browser(chr9:96,093,637-96,225,351)
NCBI Entrez Gene(211586)
IGTC(Tfdp2, 8301)
UniGene(Mm.17977)
MGI(107167)
KEGG GENES(mmu:211586)
EST Profile(Mm.17977)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB609136 GSS Location chr9:96,096,708-96,096,979 Size 272
Sequence GGAAGCGGCGCCGCCGCGGCCGTGTCGCTGAGGGCGGACGGCGTCGGGCGCGCTGGGCTGTGCGG
CCGTCGCTGCCTGGCACGCGGGGCGCGCCTTGACCCTTCCTGCACTGCAGGCTTCCGACGCGCGC
GAAGACCGCGGCTGCGCGGCCGGGAGCTTGCTCCGAGCGGACCTGGCTCTGCCTGAGGAGCGGCG
GCTCGCGAAGAAGCGTCTCCCCGGGAGTGGGCCGAGGGCTGTGTGGACCGGCGGCGGCCCCTCTG
CACCAAGCTGCG
Links UCSC Browser(chr9:96,096,708-96,096,979)
IGTC(Ayu21-KBW169)

Homology Search Results

[NM_001184706] Mus musculus transcription factor Dp 2 (Tfdp2), transcript variant 2, mRNA.

Mouse Information

Card ID 2324 Strain Name B6-Tfdp2Gt(pU-21KBW)169Card
Internal Code Ayu21-KBW169
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Tfdp2)

<Return to clone list