Topics

<Return to clone list

ID  21-KBW189
Registered  2011.08.19    Last Update  2018.05.27
Gene Name small nucleolar RNA host gene 15 Gene Symbol Snhg15
Chromosome 11 Genomic Location chr11:6,425,400-6,428,900
Synonyms Gm11974
Links UCSC Browser(chr11:6,425,400-6,428,900)
NCBI Entrez Gene(100041286)
IGTC
UniGene(Mm.383785)
MGI(3650059)
KEGG GENES
EST Profile(Mm.383785)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB665532 GSS Location chr11:6,428,309-6,428,788 Size 307
Sequence GTGCGCGGCTCGCTGCTGTGACCGTAACTTTAAGCACACGTGAGCGTCCTCAGCTGGCAGCCATG
GCTGGCGGGTCCTTCCTAGCATGTGCTGCGGCCCTCACCTTATCTTCCGTCATCAGGGCACAGGC
GCCGTGCAGGGCTATTCCGAGTCCAGGTAGAGATGGCTGAGCTCGGTGGCAGGAGATCAGCCTGC
GGTGGAGCAGGGACGTTTGCCCTGGGGAGACACGTGCCACCGGGTGGACATCGAGGCCCTGTGGG
TGGCCCTACAGCGTGGAAGGGATGACCGAGCTTTGGGACATGTCCTG
Links UCSC Browser(chr11:6,428,309-6,428,788)
IGTC(Ayu21-KBW189)

Homology Search Results

[AK160548] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410044B02 product:similar to Hermansky-Pudlak syndrome protein variant (Fragment) [Rattus norvegicus], full insert sequence.

Mouse Information

Card ID 1868 Strain Name B6-Gm11974Gt(pU-21KBW)189Card
Internal Code Ayu21-KBW189
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Snhg15)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list