Topics

<Return to clone list

ID  21-KBW211
Registered  2011.08.21    Last Update  2018.05.28
Gene Name transcription factor 4 Gene Symbol Tcf4
Chromosome 18 Genomic Location chr18:69,500,000-69,855,000
Synonyms 5730422P05Rik, ASP-I2, bHLHb19, E2-2, E2.2, ITF-2, ITF-2b, ME2, MITF-2A, MITF-2B, SEF-2, SEF2-1, TFE, ITF2; SEF2; SEF-2; Tcf-4
Links UCSC Browser(chr18:69,500,000-69,855,000)
NCBI Entrez Gene(21413)
IGTC(Tcf4, 14995)
UniGene(Mm.4269)
MGI(98506)
KEGG GENES(mmu:21413)
EST Profile(Mm.4269)
Other clone trapped this gene
21-KBW139
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB665560 GSS Location chr18:69,504,458-69,679,680 Size 357
Sequence GGAGGGAATTTTGTTACAGTTTGATGATGGAAAATGCAAAAACCGAGCCAGGTGCATAATCTTGT
AATCTGTGGCTAACCCTGGAACAGGACTGACTTCTATTTAAAATACTCTTTTGGGGGAACACTCA
TGTGAGACACTAAGTTCTTGCAGAAGATTTTTGTCTCTCTTTTTAAAGTCTCTTTCCTTGGAATA
TTGTGAGCATATTTGTGGCCATTGAAGATGTTTTCGCCTCCTGTAAGCAGTGGGAAAAATGGACC
AACTTCTTTGGCGAGTGGACATTTCACTGGCTCAAGTAAAACAGAAAGGGGCTCATACTCATCTT
ATGGGAGAGAAAACGTTCAGGGTTGCCACCAG
Links UCSC Browser(chr18:69,504,458-69,679,680)
IGTC(Ayu21-KBW211)

Homology Search Results

[X91753] M.musculus mRNA for transcription factor SEF2.

Mouse Information

Card ID 1864 Strain Name B6-Tcf4Gt(pU-21KBW)211Card
Internal Code Ayu21-KBW211
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Tcf4)

<Return to clone list