Topics

<Return to clone list

ID  21-KBW227
Registered  2011.04.16    Last Update  2018.05.28
Gene Name serine/arginine-rich splicing factor 11 Gene Symbol Srsf11
Chromosome 3 Genomic Location chr3:157,672,500-157,700,500
Synonyms 0610009J05Rik, 2610019N13Rik, Sfrs11
Links UCSC Browser(chr3:157,672,500-157,700,500)
NCBI Entrez Gene(69207)
IGTC(Srsf11, 1523)
UniGene(Mm.223946)
MGI(1916457)
KEGG GENES(mmu:69207)
EST Profile(Mm.223946)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB626085 GSS Location chr3:157,689,730-157,694,615 Size 293
Sequence CAGGAGGCAGCCCGCGCCATGAGCAGCACGGCAGTGGTCCCCAGCGCGCCAGGCCCGGGCCCAGG
CCCCAGTGGCGGGCCAGGCGGCGGCACCGAGGTGATCCAGGTGACCAACGTGTCTCCGAGCGCCA
GCTCAGAGCAGATGCGTACGCTCTTCGGCTTCCTGGGCAAGATCGACGAGCTGCGCCTCTTCCCG
CCGGATGACTCACCTTTGCCAGTCTCCTCTCGTGTCTGCTTTGTTAAGTTCCATGATCCAGACTC
AGCAGTTGTGGCACAGCATCTGACAAACACTGT
Links UCSC Browser(chr3:157,689,730-157,694,615)
IGTC(Ayu21-KBW227)

Homology Search Results

[NM_001093753] Mus musculus serine/arginine-rich splicing factor 11 (Srsf11), transcript variant 1, mRNA.

Mouse Information

Card ID 2258 Strain Name B6-Srsf11Gt(pU-21KBW)227Card
Internal Code Ayu21-KBW227
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Srsf11)

<Return to clone list