Topics

<Return to clone list

ID  21-KBW234
Registered  2011.04.17    Last Update  2018.05.28
Gene Name translin-associated factor X Gene Symbol Tsnax
Chromosome 8 Genomic Location chr8:127,536,000-127,559,000
Synonyms Trax
Links UCSC Browser(chr8:127,536,000-127,559,000)
NCBI Entrez Gene(53424)
IGTC(Tsnax, 9741)
UniGene(Mm.5248)
MGI(1855672)
KEGG GENES(mmu:53424)
EST Profile(Mm.5248)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB626090 GSS Location chr8:127,536,962-127,539,669 Size 371
Sequence TCCGGCGGCCGCATACTGCGACCAGGGTGGTGTGCGCTGTCACCCACGGGCTCAGCGCGGCGTCC
CGCGACGGCCTTTCGCTGAGCTGGCCCGGCGGCTGCGATCCCTGCGCGTGCAAGCCGAGGCCCCG
CGGCCATGAACGGCAAAGAAGGACCAGGAGGGTTCAGGAAGAGGAAGCATGACACCTTCCCACAT
AACCAAAGGAGAGAGGGGAAGGATGCCAGTTTGTCTTCGCCGGTGATGCTGGCCTTCAAATCATT
TCAGCAGGAGCTGGACGCCAGGCACGACAAATATGAGAGACTCGTGAAGCTAAGCCGGGATATTA
CTGTGGAGAGTAAGAGGACAATTTTTCTTCTCCATAGGATTACAAG
Links UCSC Browser(chr8:127,536,962-127,539,669)
IGTC(Ayu21-KBW234)

Homology Search Results

[NM_016909] Mus musculus translin-associated factor X (Tsnax), mRNA.

Mouse Information

Card ID 2259 Strain Name B6-TsnaxGt(pU-21KBW)234Card
Internal Code Ayu21-KBW234
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Tsnax)

<Return to clone list