Topics

<Return to clone list

ID  21-KBW238
Registered  2011.04.17    Last Update  2018.05.28
Gene Name L-2-hydroxyglutarate dehydrogenase Gene Symbol L2hgdh
Chromosome 12 Genomic Location chr12:70,791,000-70,827,000
Synonyms MGC:28775, BC016226
Links UCSC Browser(chr12:70,791,000-70,827,000)
NCBI Entrez Gene(217666)
IGTC(L2hgdh, 16039)
UniGene(Mm.103362)
MGI(2384968)
KEGG GENES(mmu:217666)
EST Profile(Mm.103362)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB626091 GSS Location chr12:70,803,190-70,813,665 Size 423
Sequence GAAGGCCTGAGGCTGATCCAGCAGGAGGATATAAAAAAGAAGGAGCCGTATTGCAGGGGTCTAAT
GGCTATTGATTGTCCATACACCGGCATTGTGAACTACCAACAGGTAGCTTTGTCATTTGCCCAGG
ATTTCCAAGAAGCAGGTGGCTCTATCTTGAGAGATTTTGAGGTAAAAGGTATTGAAATAGCTAAA
GAAAACTCTTCAAGAAGTAAAGATGGCATGAACTATCCAATCGCTGTCAAGAACAGCAAGGGAAA
GGAGATTCGGTGTCGATATGTTGTCACATGTGCTGGTCTTTACTCTGACCGTATTTCAGAGTTGA
GTGGCTGCAATCCTGACCCTCAAATTGTCCCATTCCGGGGAGATTACCTGGTCTTAAAGCCAGAA
AAGGGCTACCTTGTAAAAGGAAATATTTATCCG
Links UCSC Browser(chr12:70,803,190-70,813,665)
IGTC(Ayu21-KBW238)

Homology Search Results

[NM_145443] Mus musculus L-2-hydroxyglutarate dehydrogenase (L2hgdh), nuclear gene encoding mitochondrial protein, mRNA.

Mouse Information

Card ID 2260 Strain Name B6-L2hgdhGt(pU-21KBW)238Card
Internal Code Ayu21-KBW238
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for L2hgdh)

<Return to clone list