Topics

<Return to clone list

ID  21-KBW243
Registered  2011.06.22    Last Update  2018.05.28
Gene Name centromere protein S Gene Symbol Cenps
Chromosome 4 Genomic Location chr4:148,502,000-148,512,000
Synonyms 2610040C18Rik, 2810407L01Rik, Apitd1, CENP-S
Links UCSC Browser(chr4:148,502,000-148,512,000)
NCBI Entrez Gene(69928)
IGTC(Cenps, 29892)
UniGene(Mm.260893)
MGI(1917178)
KEGG GENES(mmu:69928)
EST Profile(Mm.260893)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB639762 GSS Location chr4:148,505,748-148,511,659 Size 233
Sequence GCGCGCCGACCGGGGTTGTCCGCAGTGATGGAGGAGGTGGAGGCTGAGGAGCCGCAGGAGTTCTC
TCACCGGCAGAGGCTGAAGGCGGCAGTTCACTACACGGTCGGCTGTCTCTGCCAGGAAGTCACGC
TGAACAAACAGGTGAACTTCAGCAAACAGACCATCGCGGCGATCTCCGAGGTGACTTTTCGACAG
TGCGAAAATTTTGCCAAAGACCTTGAAATGTTTGCCAG
Links UCSC Browser(chr4:148,505,748-148,511,659)
IGTC

Homology Search Results

[NM_027263] Mus musculus apoptosis-inducing, TAF9-like domain 1 (Apitd1), mRNA.

Mouse Information

Card ID 2261 Strain Name B6-Apitd1Gt(pU-21KBW)243Card
Internal Code Ayu21-KBW243
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Cenps)

<Return to clone list