Topics

<Return to clone list

ID  21-KBW264
Registered  2011.08.21    Last Update  2015.08.19
Gene Name EST Gene Symbol EST
Chromosome 14 Genomic Location chr14:76,915,549-76,931,242
Synonyms
Links UCSC Browser(chr14:76,915,549-76,931,242)
NCBI Entrez Gene
IGTC
UniGene(Mm.455633)
MGI
KEGG GENES
EST Profile(Mm.455633)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB665542 GSS Location chr14:76,915,751-76,915,904 Size 154
Sequence GGTCATTGAAGTTTCAAAAGCTAGACCCTGGCCAGGGTCTTTCTCTTCCTGCCGCGCTCCCTCAG
AACTGGCTGAAGAACACTAGCTACTTCTCCAGCTGCGTGCCGCCATGTTCCCTGTCATGGGGATA
AAGGGACTAAATCCCTCTGAAACG
Links UCSC Browser(chr14:76,915,751-76,915,904)
IGTC(Ayu21-KBW264)

Homology Search Results

[AV508265] AV508265 Abe mouse ES cell Mus musculus cDNA clone 20000120EK03D01, mRNA sequence.

Mouse Information

Card ID 1869 Strain Name B6-Gt(pU-21KBW)264Card
Internal Code Au21-KBW264
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for EST)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list