Topics

<Return to clone list

ID  21-KBW60
Registered  2008.09.15    Last Update  2018.05.29
Gene Name transcription factor 12 Gene Symbol Tcf12
Chromosome 9 Genomic Location chr9:71,685,000-71,965,000
Synonyms ALF1, bHLHb20, HEB, HEBAlt, HTF4, HTF-4, ME1, REB, A130037E08Rik
Links UCSC Browser(chr9:71,685,000-71,965,000)
NCBI Entrez Gene(21406)
IGTC(Tcf12, 7063)
UniGene(Mm.171615)
MGI(101877)
KEGG GENES(mmu:21406)
EST Profile(Mm.171615)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB453866 GSS Location chr9:71,848,223-71,848,325 Size 116
Sequence TGATTCATCTAGAGGTTTTACAGACAGCCCTCATTACAGTGATCACTTGAATGACAGTCGATTAG
GAACCCACGAAGGCTTGTCCCCAACACCTTTCATGAACTCAAATCTGATAG
Links UCSC Browser(chr9:71,848,223-71,848,325)
IGTC(Ayu21-KBW60)

Homology Search Results

[X64840] M.musculus ALF1 mRNA.

Mouse Information

Card ID 1258 Strain Name B6-Tcf12Gt(pU-21KBW)60Card
Internal Code Ayu21-KBW60
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Tcf12)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list