Topics

<Return to clone list

ID  21-KBW69
Registered  2008.09.15    Last Update  2018.05.29
Gene Name zinc finger protein 423 Gene Symbol Zfp423
Chromosome 8 Genomic Location chr8:90,185,000-90,490,000
Synonyms ataxia1, Ebfaz, mKIAA0760, Roaz, Zfp104, nur12, Znf423
Links UCSC Browser(chr8:90,185,000-90,490,000)
NCBI Entrez Gene(94187)
IGTC(Zfp423, 3201)
UniGene(Mm.23452)
MGI(1891217)
KEGG GENES(mmu:94187)
EST Profile(Mm.23452)
Other clone trapped this gene
21-T460, 21-W338, 21-W401
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB457014 GSS Location chr8:90,428,388-90,483,456 Size 420
Sequence GGCCGAGTGCCTCCGGACTCCCCGCGCCGCTTGGACCGCCGCTTGGACCCGGAGCCCCCGGCTGC
CGCATTGCAACAGCAGGGCCCCGGCGCGCCCCCCGGGCCTCCCCCGGTCCCCCAGCGGCCTGGGC
CGTCCAGGGCTGTCCCCTACAGGGAGGCTGCCCGGGACCTGCGGTCCGTTCCTTACGGCCGCCGA
CCCGGCTGCAAAAAACAAAGTTTCCGAGAGGCAGGAGGAGAAGGGGGAGAAGGGCTGCCCGGAGC
GGCGGGGGGCGGTGCGGGGAGCCGACCGCGGACGGCGACGGAGCGCCCGGAGCCCCGGACATGTC
CAGGCGGAAGCAGGCGAAGCCGCGATCGGTGAAAGTTGAAGAGGGGGAGGCCTCGGACTTCTCGC
TGGCCTGGGATTCCTCTGTGGCAGCAGCAG
Links UCSC Browser(chr8:90,428,388-90,483,456)
IGTC(Ayu21-KBW69)

Homology Search Results

[AY256893] Mus musculus early B-cell factor-associated zinc finger protein (Ebfaz) mRNA, complete cds, alternatively spliced.

Mouse Information

Card ID 1596 Strain Name B6-Zfp423Gt(pU-21KBW)69Card
Internal Code Ayu21-KBW69
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Zfp423)

<Return to clone list