Topics

<Return to clone list

ID  21-KBW70
Registered  2008.09.15    Last Update  2018.05.29
Gene Name Wilms' tumour 1-associating protein Gene Symbol Wtap
Chromosome 17 Genomic Location chr17:13,158,000-13,186,000
Synonyms 2810408K05Rik, 9430038B09Rik
Links UCSC Browser(chr17:13,158,000-13,186,000)
NCBI Entrez Gene(60532)
IGTC(Wtap, 4905)
UniGene(Mm.275521)
MGI(1926395)
KEGG GENES(mmu:60532)
EST Profile(Mm.275521)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB457015 GSS Location chr17:13,174,616-13,176,379 Size 116
Sequence GGTCCGACTGAGTGAAACAGACTTCAAAGTTATGGCACGGGATGAGTTAATTCTAAGATGGAAAC
AATATGAAGCATATGTTCAAGCTTTGGAGGGAAAGTACACAGATCTTAATT
Links UCSC Browser(chr17:13,174,616-13,176,379)
IGTC(Ayu21-KBW70)

Homology Search Results

[BC047338] Mus musculus Wilms' tumour 1-associating protein, mRNA (cDNA clone IMAGE:3155003).

Mouse Information

Card ID 1627 Strain Name B6-WtapGt(pU-21KBW)70Card
Internal Code Ayu21-KBW70
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Wtap)

<Return to clone list