Topics

<Return to clone list

ID  21-KBW75
Registered  2008.09.15    Last Update  2018.05.29
Gene Name protein tyrosine phosphatase, receptor type, G Gene Symbol Ptprg
Chromosome 14 Genomic Location chr14:12,370,000-13,100,000
Synonyms 5430405N12Rik, RPTPgamma, AW046354; AW549872
Links UCSC Browser(chr14:12,370,000-13,100,000)
NCBI Entrez Gene(19270)
IGTC(Ptprg, 598)
UniGene(Mm.431266)
MGI(97814)
KEGG GENES(mmu:19270)
EST Profile(Mm.431266)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB457019 GSS Location chr14:12,386,656-12,553,733 Size 296
Sequence CGAGCCGTGAAAGCCTCCAGGCTTAGCGGAGCCTCGCTCGGAAGCAAGAACTTATTCAACAAGTT
TACCCCCCCTGCCTTTCTCTTTTCGATGTGCGTTTTCGGACATGCGGAGGTTACTGGAACCGTGT
TGGTGGATTTTGTTCCTGAAAATCACCAGTTCTGTGCTTCATTATGTGGTGTGCTTCCCGGCATT
GACTGAAGGCTATGTGGGGACCCTGCAGGAGAGCAGACAGGACAGCTCAGTGCAGATCCGCAGAC
GAAAGGCATCCGGAGACCCATACTGGGCGTATTCTG
Links UCSC Browser(chr14:12,386,656-12,553,733)
IGTC(Ayu21-KBW75)

Homology Search Results

[L09562] Mouse receptor-type protein tyrosine phosphatase gamma homolog mRNA, complete cds.

Mouse Information

Card ID 1241 Strain Name B6-PtprgGt(pU-21KBW)75Card
Internal Code Ayu21-KBW75
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Ptprg)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list