Topics

<Return to clone list

ID  21-KBW81
Registered  2008.09.15    Last Update  2018.05.29
Gene Name SH3 domain protein D19 Gene Symbol Sh3d19
Chromosome 3 Genomic Location chr3:85,770,000-85,940,000
Synonyms Kryn; AW011754
Links UCSC Browser(chr3:85,770,000-85,940,000)
NCBI Entrez Gene(27059)
IGTC(Sh3d19, 9514)
UniGene(Mm.2454)
MGI(1350923)
KEGG GENES(mmu:27059)
EST Profile(Mm.2454)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB457022 GSS Location chr3:85,775,234-85,844,787 Size 153
Sequence CATGGCTGAGGGCCGGCGGCGGGAGGACGAGGAGGAAGAGCTGCGAGAGCGCCGCGAGCTTGGGG
GCCCGCGCCGCGCCCGGAGCCGCGCGCTCCCGGGCCACTCGGCTGCAGATCGCAACGAGCGACAT
AAGCCAGAGCATCGTTCTTCCAG
Links UCSC Browser(chr3:85,775,234-85,844,787)
IGTC(Ayu21-KBW81)

Homology Search Results

[AK187574] Mus musculus cDNA, clone:Y0G0142F05, strand:unspecified.

Mouse Information

Card ID 1863 Strain Name B6-Sh3d19Gt(pU-21KBW)81Card
Internal Code Ayu21-KBW81
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Sh3d19)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list