Topics

<Return to clone list

ID  21-KBW85
Registered  2008.09.15    Last Update  2018.05.29
Gene Name predicted gene 12588 Gene Symbol Gm12588
Chromosome 11 Genomic Location chr11:121,766,817-121,788,128
Synonyms OTTMUSG00000007612
Links UCSC Browser(chr11:121,766,817-121,788,128)
NCBI Entrez Gene(100503228)
IGTC(Gm12588, 36136)
UniGene
MGI(3800295)
KEGG GENES
EST Profile
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB458376 GSS Location chr11:121,786,544-121,786,645 Size 102
Sequence AATTAGTCGCTGAGAGGCTTGAATGGGCCTGTGTGCTGTGCTCCTTGTTCTGCGGCTGGATGCTG
TGGACTGTGCTTAGGCAAGCTCCGAAGTTGCGACATG
Links UCSC Browser(chr11:121,786,544-121,786,645)
IGTC(Ayu21-KBW85)

Homology Search Results

[CZ294402] P066H05 GV09C05 Mus musculus cDNA clone P066H05, mRNA sequence. German Genetrap Consortium (GGTC).

Mouse Information

Card ID 1886 Strain Name B6-Gm12588Gt(pU-21KBW)85Card
Internal Code Ayu21-KBW85
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Gm12588)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list