Topics

<Return to clone list

ID  21-KBW90
Registered  2008.09.15    Last Update  2018.05.29
Gene Name electron transferring flavoprotein, beta polypeptide Gene Symbol Etfb
Chromosome 7 Genomic Location chr7:50,699,000-50,714,000
Synonyms 0610009I16Rik, 2810441H06Rik
Links UCSC Browser(chr7:50,699,000-50,714,000)
NCBI Entrez Gene(110826)
IGTC(Etfb, 23015)
UniGene(Mm.30200)
MGI(106098)
KEGG GENES(mmu:110826)
EST Profile(Mm.30200)
Other clone trapped this gene
Trap vector pU-21W Cell Line KAB6 (Albino B6) Method 5'-RACE
Accession AB458377 GSS Location chr7:50,699,500-50,699,574 Size 75
Sequence AGTGACTGCTGCAGGAAGATGGCGGAGCTGCGCGCGCTCGTGGCTGTCAAGAGGGTCATCGACTT
CGCTGTGAAG
Links UCSC Browser(chr7:50,699,500-50,699,574)
IGTC(Ayu21-KBW90)

Homology Search Results

[BC069877] Mus musculus electron transferring flavoprotein, beta polypeptide, mRNA (cDNA clone MGC:78079 IMAGE:5370580), complete cds.

Mouse Information

Card ID 1270 Strain Name B6-EtfbGt(pU-21KBW)90Card
Internal Code Ayu21-KBW90
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and ES cell line; KAB6 (Albino B6). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Etfb)

Expression Information

Description X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female

<Return to clone list