Topics

<Return to clone list

ID  21-MT54
Registered  2013.02.23    Last Update  2018.05.31
Gene Name RIKEN cDNA 2410002F23 gene Gene Symbol 2410002F23Rik
Chromosome 7 Genomic Location chr7:51,502,004-51,507,839
Synonyms
Links UCSC Browser(chr7:51,502,004-51,507,839)
NCBI Entrez Gene(668661)
IGTC(2410002F23Rik, 34717)
UniGene(Mm.274492)
MGI(1914226)
KEGG GENES(mmu:668661)
EST Profile(Mm.274492)
Other clone trapped this gene
Trap vector pU-21T Cell Line Mol/MSM-1 Method 5'-RACE
Accession AB695244 GSS Location chr7:51,503,620-51,505,710 Size 175
Sequence AGGTGTATCTTGAAGCCACGTAGCCATCCATCATCATCTTACTGTGGTGGCTGAGGCGGGAGGAT
CCTGAGTTAACATCCAGACTGGACTACATACAAAAATAAACAGAGGCAGTTCCTTCAGACAACCA
GGCTTCCCTCCAGGTGGTTTCTACAAACATCCTACTTCCCTTCAG
Links UCSC Browser(chr7:51,503,620-51,505,710)
IGTC

Homology Search Results

[NM_025880] Mus musculus RIKEN cDNA 2410002F23 gene (2410002F23Rik), mRNA.

Mouse Information

Card ID 1959 Strain Name MSM/Ms-2410002F23RikGt(pU-21MT)54Card
Internal Code Ayu21-MT54
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; Mol/MSM-1. Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for 2410002F23Rik)

<Return to clone list