Topics

<Return to clone list

ID  21-MT68
Registered  2013.02.23    Last Update  2018.05.31
Gene Name 45S rRNA gene intergenic spacer Gene Symbol 45SrRNAint
Chromosome Unlocalized Genomic Location
Synonyms
Links UCSC Browser
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
21-MT9, 21-108, 21-B148, 21-T335, 21-39, 21-B113, 21-T23, 21-MT81, 21-T105, 21-B130, 21-T107, 21-MT6, 21-MT33, 21-MT71, 21-MT14, 21-MT35, 21-MT10, 21-MT37, 21-MT75, 21-MT86, 21-MT7, 21-MT49, 21-T212, 21-T223, 21-T235, 21-T251, 21-MT2, 21-MT34, 21-MT69, 21-MT77, 21-MT43, 21-MT26, 21-MT55, 21-MT100, 21-MT104, 21-MT106, 21-MT112, 21-MT125, 21-MT128, 21-B143
Trap vector pU-21T Cell Line Mol/MSM-1 Method 5'-RACE
Accession AB695246 GSS Location Size 128
Sequence GCCAGAGCCAGAGCAAATGTGGACCTGAAAGGACAGTGAGTTCAGAGAATTCACAGGGAAATCAT
CACTCAGGGACTTCAGGCAGAAAACTAGCCAGTCAGCCTCTGGATAGACAAGGCTCAACAGAT
Links UCSC Browser
IGTC

Homology Search Results

[BK000964] TPA_exp: Mus musculus ribosomal DNA, complete repeating unit.

Mouse Information

Card ID 1948 Strain Name MSM/Ms-45SrRNAintGt(pU-21MT)68Card
Internal Code Ayu21-MT68
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; Mol/MSM-1. Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for 45SrRNAint)

<Return to clone list