Topics

<Return to clone list

ID  21-MT89
Registered  2013.02.24    Last Update  2018.11.12
Gene Name New Gene Symbol New
Chromosome Unlocalized Genomic Location
Synonyms
Links UCSC Browser
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone traped this gene
Trap vector pU-21T Cell Line Mol/MSM-1 Method 5'-RACE
Accession AB695249 GSS Location Size 208
Sequence GGAGGGGNTAAAGTCTCATGTTGAGAGACGCTATCATGCATGTCACGAGTTAGTATTTTGGGAGA
GGTGTTCAGCAGCCTCTGGTTCTATCTGTACCTTCAAAATCTACACAAGGCTGGACTAACCTGAA
GGAGTAAACAGGAGTCTCAGGGAGCACACAGTAGCCATGGAATACTTCCACCAAAGATATATTCG
GAAGGTCTATAAG
Links UCSC Browser
IGTC

Homology Search Results

[CC326788] RRI199 BayGenomics Gene Trap Library pGT0Lxf Mus musculus cDNA, mRNA sequence.

Mouse Information

Card ID 1956 Strain Name MSM/Ms-Gt(pU-21MT)89Card
Internal Code Ayu21-MT89
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and ES cell line; Mol/MSM-1. Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for New)

<Return to clone list