Topics

<Return to clone list

ID  21-T100
Registered  2006.11.30    Last Update  2018.06.01
Gene Name Fas-associated factor 1 Gene Symbol Faf1
Chromosome 4 Genomic Location chr4:109,345,000-109,650,000
Synonyms Dffrx, Fam, AA408698
Links UCSC Browser(chr4:109,345,000-109,650,000)
NCBI Entrez Gene(14084)
IGTC(Faf1, 134)
UniGene(Mm.318259)
MGI(109419)
KEGG GENES(mmu:14084)
EST Profile(Mm.318259)
Other clone trapped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB285203 GSS Location chr4:109,349,259-109,349,677 Size 419
Sequence TGCTCCTTCTCTCGCTTTCCCCGCCCCCGTCGGGTTTGCCGTGGCTGGAGGGAGCCGGGCGCGCG
CTGTCGCAACCTGTCCTCCTCCCAGGCGGCGACGGAAGGACCGGCCCGGCATCGAGACCAGCCTC
CCCGTCCCGGCAGCTGCGGCGAGGGCTCCGCGGGGCGCAGGCGGGCTCAGGGCGGCTGAAGGTTA
CCGAGTGCATGAGCACCTAGTCTCCCGCGCTGCCCCGCCCGCCGGTCCGCCGGCCCTCCCGCCGG
CTCGCCCGCCAGCCCTTCGCCACCCGGCGGCGGCCGCAGCTTCGGCCGCAGGAGGCGCCGTCTCG
CTCCCAGGTGCGCGCTTCGTTCCCGGAGCCGCGGAGCTCGGCGGCCGCCATGGCGTCCAACATGG
ACCGGGAGATGATCCTTGCGGATTTTCAG
Links UCSC Browser(chr4:109,349,259-109,349,677)
IGTC(Ayu21-T100)

Homology Search Results

[BC065098] Mus musculus Fas-associated factor 1, mRNA (cDNA clone MGC:86078 IMAGE:30362116), complete cds.

Mouse Information

Card ID 759 Strain Name B6;CB-Faf1Gt(pU-21T)100Imeg
Internal Code Ayu21-T100
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Faf1)

<Return to clone list