Topics |
Gene Name | cleft lip and palate associated transmembrane protein 1 | Gene Symbol | Clptm1 | ||||
---|---|---|---|---|---|---|---|
Chromosome | 7 | Genomic Location | chr7:20,216,000-20,252,000 | ||||
Synonyms | HS9, N14 | ||||||
Links | UCSC Browser(chr7:20,216,000-20,252,000) NCBI Entrez Gene(56457) IGTC(Clptm1, 4264) UniGene(Mm.290960) |
MGI(1927155) KEGG GENES(mmu:56457) EST Profile(Mm.290960) |
Other clone trapped this gene |
---|
Trap vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
---|---|---|---|---|---|
Accession | AB286657 | GSS Location | chr7:20,250,283-20,250,369 | Size | 87 |
Sequence | ACCCGGAGCAGGAAGATGGCGGCGGCGCAGGAGGCGGACGGGGCCGGCAGCGCCGTGGTGGCGGC CGGGGGAGGCAGCTCTGGTCAG |
||||
Links | UCSC Browser(chr7:20,250,283-20,250,369) IGTC(Ayu21-T102) |
[AK165742] Mus musculus 13 days embryo spinal cord cDNA, RIKEN full-length enriched library, clone: G630040L22 product:cleft lip and palate associated transmembrane protein 1, full insert sequence. |
Card ID | Strain Name | ||
---|---|---|---|
Internal Code | |||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||
Links |
IMSR (for Clptm1) |