Topics

<Return to clone list

ID  21-T108
Registered  2006.12.29    Last Update  2018.06.01
Gene Name abhydrolase domain containing 12 Gene Symbol Abhd12
Chromosome 2 Genomic Location chr2:150,658,000-150,733,000
Synonyms 1500011G07Rik, 6330583M11Rik, AI431047, AW547313
Links UCSC Browser(chr2:150,658,000-150,733,000)
NCBI Entrez Gene(76192)
IGTC(Abhd12, 9635)
UniGene(Mm.112632)
MGI(1923442)
KEGG GENES(mmu:76192)
EST Profile(Mm.112632)
Other clone trapped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB289442 GSS Location chr2:150,730,093-150,730,263 Size 171
Sequence CGTCACCTTGGAGCATGAGCGCTGCGCCGCCTCAGGCTCGTCCTCCTCCGGCTCGGCCGCCGCGG
CGCTGGACGCCGACTGCAGCTTGAAGCAGAACCTGCGTCTGGCGGGCAAGGGGACGGCAGAGCCG
CACAGCGCATCCGACGCGGGCATGAAGCGGGCGCTGGGCAG
Links UCSC Browser(chr2:150,730,093-150,730,263)
IGTC(Ayu21-T108)

Homology Search Results

[BC002138] Mus musculus abhydrolase domain containing 12, mRNA (cDNA clone IMAGE:3484538), partial cds.

Mouse Information

Card ID 1075 Strain Name B6;CB-Abhd12Gt(pU-21T)108Imeg
Internal Code Ayu21-T108
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Abhd12)

<Return to clone list