| Topics |
ID 21-T114
| Gene Name | pluripotency associated transcript 3 | Gene Symbol | Platr3 | ||||
|---|---|---|---|---|---|---|---|
| Chromosome | 2 | Genomic Location | chr2:135,466,385-135,483,166 | ||||
| Synonyms | Gm14074 | ||||||
| Links | UCSC Browser(chr2:135,466,385-135,483,166) NCBI Entrez Gene(102642414) IGTC UniGene(Mm.156895) |
MGI(3651129) KEGG GENES EST Profile(Mm.156895) |
|||||
| Other clone trapped this gene |
|---|
| Trap vector | pU-21T | Cell Line | KTPU8 | Method | 5'-RACE |
|---|---|---|---|---|---|
| Accession | AB278135 | GSS Location | chr2:135,472,259-135,477,293 | Size | 132 |
| Sequence | CCCCTTTTGGAATGGGACAGCAGAGGGGGCTGTGTTTCATCTCAGCGATCAACTGGTTGACCTAT ATGTGAGGGCAAGATTTTACACTCCTTTGAGGTGAGACAGACCAACAGATACCTGTAAACCAATG AG |
||||
| Links | UCSC Browser(chr2:135,472,259-135,477,293) IGTC(Ayu21-T114) |
||||
Homology Search Results
| [BG091049] mac20a09.y1 Soares mouse 3NbMS Mus musculus cDNA clone IMAGE:4000049 5', mRNA sequence. |
Mouse Information
| Card ID | Strain Name | ||
|---|---|---|---|
| Internal Code | |||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||
| Links |
IMSR (for Platr3) |
||