Topics

<Return to clone list

ID  21-T155
Registered  2007.01.18    Last Update  2018.06.01
Gene Name transcriptional regulating factor 1 Gene Symbol Trerf1
Chromosome 17 Genomic Location chr17:47,270,000-47,500,000
Synonyms 9430096I18Rik, Trep132, Trep-132, RAPA, AI429294, B830015H24
Links UCSC Browser(chr17:47,270,000-47,500,000)
NCBI Entrez Gene(224829)
IGTC(Trerf1, 14289)
UniGene(Mm.260989)
MGI(2442086)
KEGG GENES(mmu:224829)
EST Profile(Mm.260989)
Other clone trapped this gene
21-W393, 21-W479, 21-KBW258, K14A05
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB290809 GSS Location chr17:47,278,773-47,278,858 Size 87
Sequence ACTCGGCTCGCCCCCCATCTCACCCCCCCAAGTGGAGATTGGTCGTCTTGTCGGATTGCCCAGGC
ACTTGTTGCCGAAACAGCCAAG
Links UCSC Browser(chr17:47,278,773-47,278,858)
IGTC(Ayu21-T155)

Homology Search Results

[BC059215] Mus musculus transcriptional regulating factor 1, mRNA (cDNA clone MGC:66566 IMAGE:6412734), complete cds.

Mouse Information

Card ID 1099 Strain Name B6;CB-Tref1Gt(pU-21T)155Imeg
Internal Code Ayu21-T155
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Trerf1)

<Return to clone list