Topics

<Return to clone list

ID  21-T180
Registered  2007.02.03    Last Update  2018.06.01
Gene Name transmembrane protein 248 Gene Symbol Tmem248
Chromosome 5 Genomic Location chr5:130,695,000-130,720,000
Synonyms AW557951; 0610007L01Rik; A930023A16Rik; G430067H08Rik
Links UCSC Browser(chr5:130,695,000-130,720,000)
NCBI Entrez Gene(71667)
IGTC(Tmem248, 8)
UniGene(Mm.258508)
MGI(1918917)
KEGG GENES(mmu:71667)
EST Profile(Mm.258508)
Other clone trapped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB292615 GSS Location chr5:130,698,219-130,698,442 Size 224
Sequence CCTTCACCCGGAAAGCCCGGCGTTCGCAGCGCGCGGAGCCGGCGTCCCGTTGGCGCGCTCTGGCC
TGGCTTCGGGTCGTCGCTTCGGCCCCGAGGAGCCGCTCGCTGTCTCCGGAGCGGCGGAGAGGATG
GTGCGGGGCAGCCCGGGGCCCGCCGCGCTCCGCCGCGAGTGAACAGGGCCAGGCCGCGGGCGTCC
GCGGGCTCGAGCCGCCAGTCTGCGGGGCG
Links UCSC Browser(chr5:130,698,219-130,698,442)
IGTC(Ayu21-T180)

Homology Search Results

[AK142176] Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330005J15 product:hypothetical protein, full insert sequence.

Mouse Information

Card ID 1035 Strain Name B6;CB-Tmem248Gt(pU-21T)180Imeg
Internal Code Ayu21-T180
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
Links IMSR (for Tmem248)

<Return to clone list