Topics

<Return to clone list

ID  21-T2
Registered  2006.11.30    Last Update  2019.08.01
Gene Name musashi RNA-binding protein 2 Gene Symbol Msi2
Chromosome 11 Genomic Location chr11:88,150,000-88,590,000
Synonyms Musashi2, Msi2h, AI451722, AI563628, AW489193, MGC118040, MGC130496, 1700105C15Rik
Links UCSC Browser(chr11:88,150,000-88,590,000)
NCBI Entrez Gene(76626)
IGTC(Msi2, 2138)
UniGene(Mm.400451)
MGI(1923876)
KEGG GENES(mmu:76626)
EST Profile(Mm.400451)
Other clone traped this gene
21-T259, 21-W197, 21-W314, 21-MT15, 21-KBW163
Trap vector pU-21T Cell Line KTPU8 Method 5'-RACE
Accession AB285199 GSS Location chr11:88,573,752-88,579,414 Size 321
Sequence GGGCTCCGCTAGGAGGCAAATGGGAGCCCAGGCACCTCGGGCAGCGCCAACGACTCCCAGCACGA
CCCCGGTAAAATGTTTATCGGTGGACTGAGCTGGCAGATCTCACCAGATAGCCTTAGAGACTATT
TTAGCAAATTTGGAGAAATTAGAGAATGTATGGTCATGAGAGATCCCACAACGAAACGCTCCAGA
GGCTTCGGTTTCGTCACCTTCGCAGACCCAGCAAGTGTAGATAAAGTATTAGGTCAGCCCCACCA
TGAGTTAGATTCCAAGACGATTGACCCAAAAGTTGCATTTCCTCGTCGAGCGCAACCTAAG
Links UCSC Browser(chr11:88,573,752-88,579,414)
IGTC(Ayu21-T2)

Homology Search Results

[AK049637] Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length enriched library, clone:C530010I15 product:Musashi homolog 2 (Drosophila), full insert sequence.

Mouse Information

Card ID 836 Strain Name B6;CB-Msi2Gt(pU-21T)2Imeg
Internal Code Ayu21-T2
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Regulation of myeloid leukaemia by the cell-fate determinant Musashi." Ito T., Kwon, HY., Zimdahl B., Congdon KL., Blum J., Lento WE., Zhao C., Lagoo A., Gerrard G., Foroni L., Goldman J., Goh H., Kim SH., Kim DW., Chuah C., Oehler VG., Radich J., Jordan CT. and Reya T., Nature, 466, 765-768 (2010). PubMed ID:20639863.
[Paper] "Image-based detection and targeting of therapy resistance in pancreatic adenocarcinoma." Fox, R.G., Lytle NK., Jaquish DV., Park FD., Ito T., Bajaj J., Koechlein CS., Zimdahl B., Yano M., Kopp JL., Kritzik M., Sicklick JK., Sander M., Grandgenett PM., Hollingsworth MA., Shibata S., Pizzo D., Valasek MA., Sasik R., Scadeng M., Okano H., Kim Y., MacLeod AR., Lowy AM. and Reya T., Nature,534,407-411 (2016). PubMed ID:27281208.
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
Links IMSR (for Msi2)

<Return to clone list