Topics

<Return to clone list

ID  21-T237
Registered  2012.02.13    Last Update  2015.05.26
Gene Name New Gene Symbol New
Chromosome 2 Genomic Location chr2:129,045,000-129,120,000
Synonyms
Links UCSC Browser(chr2:129,045,000-129,120,000)
NCBI Entrez Gene
IGTC
UniGene
MGI
KEGG GENES
EST Profile
Other clone trapped this gene
Trap vector pU-21T Cell Line KTPU8 Method 5'-Inverse PCR
Accession AB698513 GSS Location chr2:129,082,178-129,082,561 Size 413
Sequence GGCCAAGAACAGAGTTCTATCNCANACCCCAGCAANCAGCAGTAATNACCAATGGTATTGGGGAG
TGGGGAGGGTCCTTCATGTAACTNTCAGGCAAGCTCCAAAAGTACACACAGGAAGAGCCCAAGGA
CATGAACAGGACCACNGTCACCACCCACCCTGTCCTTTGATCTCCTGGACCTGCCAGTCACTTAG
CTTACCCACCCCATGCCCCCAAGTCCCCCTCAAATACATTACTGTCTCTTAACAGGAGGATGTAA
GTGGTCCGGGCCCCATCCACTCAGAGACTCCAGGGAGGCTTTCCCACAAGAAATGACGATTCATA
GACCTCTTCCTCAGACAAAGCTTGGACCAGGAGAGGCCAGCCCTCCTGCTCTTTCCACATACACA
CCCCTGTACCCTGGCTCCTCAAA
Links UCSC Browser(chr2:129,082,178-129,082,561)
IGTC(Ayu21-T237)

Homology Search Results

Mouse Information

Card ID 2242 Strain Name B6.Cg-UnknownGt(pU-21T)237Card
Internal Code Ayu21-T237
Description This clone was isolated by using the exchangeable gene trap vector;pU-21T, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. This sequence-tag is genomic sequence of 5'-flanking region obtained by inverse PCR.
Links IMSR (for New)

<Return to clone list